logo

More info
  • ReceivedFeb 1, 2016
  • AcceptedFeb 22, 2016
  • PublishedApr 27, 2016

Abstract


Funded by

This study was supported by the Program for Changjiang Scholars and Innovative Research Team in University of China(IRT13007)

National S&T Major Project “China Mega-Project for Infectious Disease” from China(2011ZX10004-001,2014ZX10004001)

National Natural Science Foundation of China(81501773)

PUMC Youth Fund and Fundamental Research Funds for the Central Universities(3332015095,3332015006)


Acknowledgment

Acknowledgements This study was supported by the Program for Changjiang Scholars and Innovative Research Team in University of China (IRT13007), the National S&T Major Project “China Mega-Project for Infectious Disease” (2011ZX10004-001, 2014ZX10004001) from China, the National Natural Science Foundation of China (81501773), and the PUMC Youth Fund and Fundamental Research Funds for the Central Universities (3332015095, 3332015006).


Open access

This article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.


Interest statement

Compliance and ethics The author(s) declare that they have no conflict of interest.


References

[1] Apweiler R., Attwood T.K., Bairoch A., Bateman A., Birney E., Biswas M., Bucher P., Cerutti L., Corpet F., Croning M.D., Durbin R., Falquet L., Fleischmann W., Gouzy J., Hermjakob H., Hulo N., Jonassen I., Kahn D., Kanapin A., Karavidopoulou Y., Lopez R., Marx B., Mulder N.J., Oinn T.M., Pagni M., Servant F., Sigrist C.J., Zdobnov E.M.. The InterPro database, an integrated documentation resource for protein families, domains and functional sites. Nucleic Acids Res, 2001, 29: 37-40. CrossRef Google Scholar

[2] Bateman A., Birney E., Cerruti L., Durbin R., Etwiller L., Eddy S.R., Griffiths-Jones S., Howe K.L., Marshall M., Sonnhammer E.L.. The Pfam protein families database. Nucleic Acids Res, 2002, 30: 276-280. CrossRef Google Scholar

[3] Bosch B.J., van der Zee R., de Haan C.A., Rottier P.J.. The coronavirus spike protein is a class I virus fusion protein: structural and functional characterization of the fusion core complex. J Virol, 2003, 77: 8801-8811. CrossRef Google Scholar

[4] Chen L.L., Ou H.Y., Zhang R., Zhang C.T.. ZCURVE_CoV: a new system to recognize protein coding genes in coronavirus genomes, and its applications in analyzing SARS-CoV genomes. Biochem Biophys Res Commun, 2003, 307: 382-388. CrossRef Google Scholar

[5] Chu D.K., Peiris J.S., Chen H., Guan Y., Poon L.L.. Genomic characterizations of bat coronaviruses (1A, 1B and HKU8) and evidence for co-infections in Miniopterus bats. J Gen Virol, 2008, 89: 1282-1287. CrossRef Google Scholar

[6] Cui J., Han N., Streicker D., Li G., Tang X., Shi Z., Hu Z., Zhao G., Fontanet A., Guan Y., Wang L., Jones G., Field H.E., Daszak P., Zhang S.. Evolutionary relationships between bat coronaviruses and their hosts. Emerg Infect Dis, 2007, 13: 1526-1532. CrossRef Google Scholar

[7] King, A.M.Q., Adams, M.J., Carstens, E.B. (2011). Virus Taxonomy, Classification and Nomenclature of Viruses. Ninth Report of the International Committee on Taxonomy of Viruses, International Union of Microbiological Societies, Virology Division. London: Elsevier Academic Press, 806–828.. Google Scholar

[8] Dveksler G.S., Pensiero M.N., Cardellichio C.B., Williams R.K., Jiang G.S., Holmes K.V., Dieffenbach C.W.. Cloning of the mouse hepatitis virus (MHV) receptor: expression in humaaan and hamster cell lines confers susceptibility to MHV. J Virol, 1991, 65: 6881-6891. Google Scholar

[9] Gonzalez J.M., Gomez-Puertas P., Cavanagh D., Gorbalenya A.E., Enjuanes L.. A comparative sequence analysis to revise the current taxonomy of the family Coronaviridae. Arch Virol, 2003, 148: 2207-2235. CrossRef Google Scholar

[10] Graham R.L., Baric R.S.. Recombination, reservoirs, and the modular spike: mechanisms of coronavirus cross-species transmission. J Virol, 2010, 84: 3134-3146. CrossRef Google Scholar

[11] Guindon S., Dufayard J.F., Lefort V., Anisimova M., Hordijk W., Gascuel O.. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3. 0. Syst Biol, 2010, 59: 307-321. CrossRef Google Scholar

[12] Herrewegh A.A., Smeenk I., Horzinek M.C., Rottier P.J., de Groot R.J.. Feline coronavirus type II strains 79-1683 and 79-1146 originate from a double recombination between feline coronavirus type I and canine coronavirus. J Virol, 1998, 72: 4508-4514. Google Scholar

[13] Holmes K.V., Enjuanes L.. Virology. The SARS coronavirus: a postgenomic era. Science, 2003, 300: 1377-1378. Google Scholar

[14] Jonassen C.M., Kofstad T., Larsen I.L., Lovland A., Handeland K., Follestad A., Lillehaug A.. Molecular identification and characterization of novel coronaviruses infecting graylag geese (Anser anser), feral pigeons (Columbia livia) and mallards (Anas platyrhynchos). J Gen Virol, 2005, 86: 1597-1607. CrossRef Google Scholar

[15] Kosakovsky Pond S.L., Posada D., Gravenor M.B., Woelk C.H., Frost S.D.. GARD: a genetic algorithm for recombination detection. Bioinformatics, 2006, 22: 3096-3098. CrossRef Google Scholar

[16] Lai M.M.. Coronavirus: organization, replication and expression of genome. Annu Rev Microbiol, 1990, 44: 303-333. CrossRef Google Scholar

[17] Lai M.M., Cavanagh D.. The molecular biology of coronaviruses. Adv Virus Res, 1997, 48: 1-100. Google Scholar

[18] Lai, M.M.C., and Holmes, K.V. (2001). Coronaviruses. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., and Straus, S.E., eds. Fields Virology. Philadelphia: Lippincott Williams & Wilkins 1163–1185.. Google Scholar

[19] Lau S.K., Li K.S., Tsang A.K., Shek C.T., Wang M., Choi G.K., Guo R., Wong B.H., Poon R.W., Lam C.S., Wang S.Y., Fan R.Y., Chan K.H., Zheng B.J., Woo P.C., Yuen K.Y.. Recent transmission of a novel alphacoronavirus, bat coronavirus HKU10, from Leschenault’s rousettes to pomona leaf-nosed bats: first evidence of interspecies transmission of coronavirus between bats of different suborders. J Virol, 2012a, 86: 11906-11918. CrossRef Google Scholar

[20] Lau S.K., Woo P.C., Li K.S., Huang Y., Tsoi H.W., Wong B.H., Wong S.S., Leung S.Y., Chan K.H., Yuen K.Y.. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc Natl Acad Sci USA, 2005, 102: 14040-14045. CrossRef Google Scholar

[21] Lau S.K., Woo P.C., Li K.S., Huang Y., Wang M., Lam C.S., Xu H., Guo R., Chan K.H., Zheng B.J., Yuen K.Y.. Complete genome sequence of bat coronavirus HKU2 from Chinese horseshoe bats revealed a much smaller spike gene with a different evolutionary lineage from the rest of the genome. Virology, 2007, 367: 428-439. CrossRef Google Scholar

[22] Lau S.K., Woo P.C., Yip C.C., Fan R.Y., Huang Y., Wang M., Guo R., Lam C.S., Tsang A.K., Lai K.K., Chan K.H., Che X.Y., Zheng B.J., Yuen K.Y.. Isolation and characterization of a novel Betacoronavirus subgroup A coronavirus, rabbit coronavirus HKU14, from domestic rabbits. J Virol, 2012b, 86: 5481-5496. CrossRef Google Scholar

[23] Li W., Shi Z., Yu M., Ren W., Smith C., Epstein J.H., Wang H., Crameri G., Hu Z., Zhang H., Zhang J., McEachern J., Field H., Daszak P., Eaton B.T., Zhang S., Wang L.F.. Bats are natural reservoirs of SARS-like coronaviruses. Science, 2005, 310: 676-679. CrossRef Google Scholar

[24] Liu S., Chen J., Kong X., Shao Y., Han Z., Feng L., Cai X., Gu S., Liu M.. Isolation of avian infectious bronchitis coronavirus from domestic peafowl (Pavo cristatus) and teal (Anas). J Gen Virol, 2005, 86: 719-725. CrossRef Google Scholar

[25] Makino S., Keck J.G., Stohlman S.A., Lai M.M.. High-frequency RNA recombination of murine coronaviruses. J Virol, 1986, 57: 729-737. Google Scholar

[26] Miller-Butterworth C.M., Jacobs D.S., Harley E.H.. Strong population substructure is correlated with morphology and ecology in a migratory bat. Nature, 2003, 424: 187-191. CrossRef Google Scholar

[27] Rest J.S., Mindell D.P.. SARS associated coronavirus has a recombinant polymerase and coronaviruses have a history of host-shifting. Infect Genet Evol, 2003, 3: 219-225. CrossRef Google Scholar

[28] Shirato K., Maeda K., Tsuda S., Suzuki K., Watanabe S., Shimoda H., Ueda N., Iha K., Taniguchi S., Kyuwa S., Endoh D., Matsuyama S., Kurane I., Saijo M., Morikawa S., Yoshikawa Y., Akashi H., Mizutani T.. Detection of bat coronaviruses from Miniopterus fuliginosus in Japan. Virus Genes, 2012, 44: 40-44. CrossRef Google Scholar

[29] Song H.D., Tu C.C., Zhang G.W., Wang S.Y., Zheng K., Lei L.C., Chen Q.X., Gao Y.W., Zhou H.Q., Xiang H., Zheng H.J., Chern S.W., Cheng F., Pan C.M., Xuan H., Chen S.J., Luo H.M., Zhou D.H., Liu Y.F., He J.F., Qin P.Z., Li L.H., Ren Y.Q., Liang W.J., Yu Y.D., Anderson L., Wang M., Xu R.H., Wu X.W., Zheng H.Y., Chen J.D., Liang G., Gao Y., Liao M., Fang L., Jiang L.Y., Li H., Chen F., Di B., He L.J., Lin J.Y., Tong S., Kong X., Du L., Hao P., Tang H., Bernini A., Yu X.J., Spiga O., Guo Z.M., Pan H.Y., He W.Z., Manuguerra J.C., Fontanet A., Danchin A., Niccolai N., Li Y.X., Wu C.I., Zhao G.P.. Cross-host evolution of severe acute respiratory syndrome coronavirus in palm civet and human. Proc Natl Acad Sci USA, 2005, 102: 2430-2435. CrossRef Google Scholar

[30] Sonnhammer E.L., von Heijne G., Krogh A.. A hidden Markov model for predicting transmembrane helices in protein sequences. Proc Int Conf Intell Syst Mol Biol, 1998, 6: 175-182. Google Scholar

[31] Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S.. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 2011, 28: 2731-2739. CrossRef Google Scholar

[32] Tang X.C., Zhang J.X., Zhang S.Y., Wang P., Fan X.H., Li L.F., Li G., Dong B.Q., Liu W., Cheung C.L., Xu K.M., Song W.J., Vijaykrishna D., Poon L.L., Peiris J.S., Smith G.J., Chen H., Guan Y.. Prevalence and genetic diversity of coronaviruses in bats from China. J Virol, 2006, 80: 7481-7490. CrossRef Google Scholar

[33] van Boheemen, S., de Graaf, M., Lauber, C., Bestebroer, T.M., Raj, V.S., Zaki, A.M., Osterhaus, A.D., Haagmans, B.L., Gorbalenya, A.E., Snijder, E.J., and Fouchier, R.A. (2012). Genomic characterization of a newly discovered coronavirus associated with acute respiratory distress syndrome in humans. MBio doi: 10.1128/mBio.00473-12.. Google Scholar

[34] Vijaykrishna D., Smith G.J., Zhang J.X., Peiris J.S., Chen H., Guan Y.. Evolutionary insights into the ecology of coronaviruses. J Virol, 2007, 81: 4012-4020. CrossRef Google Scholar

[35] Weiss S.R., Navas-Martin S.. Coronavirus pathogenesis and the emerging pathogen severe acute respiratory syndrome coronavirus. Microbiol Mol Biol Rev, 2005, 69: 635-664. CrossRef Google Scholar

[36] Woo P.C., Lau S.K., Lam C.S., Lai K.K., Huang Y., Lee P., Luk G.S., Dyrting K.C., Chan K.H., Yuen K.Y.. Comparative analysis of complete genome sequences of three avian coronaviruses reveals a novel group 3c coronavirus. J Virol, 2009, 83: 908-917. CrossRef Google Scholar

[37] Woo P.C., Lau S.K., Lam C.S., Lau C.C., Tsang A.K., Lau J.H., Bai R., Teng J.L., Tsang C.C., Wang M., Zheng B.J., Chan K.H., Yuen K.Y.. Discovery of seven novel Mammalian and avian coronaviruses in the genus deltacoronavirus supports bat coronaviruses as the gene source of alphacoronavirus and betacoronavirus and avian coronaviruses as the gene source of gammacoronavirus and deltacoronavirus. J Virol, 2012, 86: 3995-4008. CrossRef Google Scholar

[38] Woo P.C., Lau S.K., Li K.S., Poon R.W., Wong B.H., Tsoi H.W., Yip B.C., Huang Y., Chan K.H., Yuen K.Y.. Molecular diversity of coronaviruses in bats. Virology, 2006a, 351: 180-187. CrossRef Google Scholar

[39] Woo P.C., Lau S.K., Yip C.C., Huang Y., Tsoi H.W., Chan K.H., Yuen K.Y.. Comparative analysis of 22 coronavirus HKU1 genomes reveals a novel genotype and evidence of natural recombination in coronavirus HKU1. J Virol, 2006b, 80: 7136-7145. CrossRef Google Scholar

[40] Woo P.C., Lau S.K., Yuen K.Y.. Infectious diseases emerging from Chinese wet-markets: zoonotic origins of severe respiratory viral infections. Curr Opin Infect Dis, 2006c, 19: 401-407. CrossRef Google Scholar

[41] Woo P.C., Lau S.K., Huang Y., Yuen K.Y.. Coronavirus diversity, phylogeny and interspecies jumping. Exp Biol Med, 2009, 234: 1117-1127. CrossRef Google Scholar

[42] Woo P.C., Lau S.K., Yuen K.Y.. Infectious diseases emerging from Chinese wet-markets: zoonotic origins of severe respiratory viral infections. Curr Opin Infect Dis, 2006, 19: 401-407. CrossRef Google Scholar

[43] Wu Z., Yang L., Ren X., He G., Zhang J., Yang J., Qian Z., Dong J., Sun L., Zhu Y., Du J., Yang F., Zhang S., Jin Q.. Deciphering the bat virome catalog to better understand the ecological diversity of bat viruses and the bat origin of emerging infectious diseases. ISME J, 2015, 10: 609-620. Google Scholar

[44] Zeng Q., Langereis M.A., van Vliet A.L., Huizinga E.G., de Groot R.J.. Structure of coronavirus hemagglutinin-esterase offers insight into corona and influenza virus evolution. Proc Natl Acad Sci USA, 2008, 105: 9065-9069. CrossRef Google Scholar

  • Figure 1

    The nine provinces (indicated in blue) in China, where bats were captured, and samples were collected. The numbers on the right indicate the numbers of samples positive for Lineage 1 (L1) and Lineage 2 (L2) and the total number of samples collected in each province. The red shading on Guangdong and Henan indicate the regions where co-infections of two lineages were detected.

  • Figure 2

    Phylogenetic trees based on the amino acid sequences of the partial RNA-dependent RNA polymerase (RdRp; an 324-nt sequence fragment corresponding to positions 14828–15151 in bat coronavirus (BtCoV-HKU8; NC010438)), full-length spike (S), envelope (E), membrane (M), and nucleocapsid (N) proteins. The following CoVs and GenBank accession numbers were used: BtCoV-1A (NC010437), BtCoV-1B (NC010436), BtCoV-HKU7 (DQ249226), BtCoV-HKU2 (NC009988), BtCoV-HKU10 (NC018871), BtCoV-512 (NC009657), BtCoV-Mf/Japan/01/2009 (AB619638), BtCoV- Mf/Japan/02/2009 (AB619639), BtCoV-Mf/Japan/01/2010 (AB619640), BtCoV-Mf/Japan/03/2010 (AB619642), BtCoV-A773/2005 (DQ648835), Feline infectious peritonitis virus (FIPV; AY994055), Canine CoV-341/05 (EU856361), BtCoV-HKU9 (EF065513), severe acute respiratory syndrome coronavirus (SARS-CoV; NC004718), human CoV OC43 (HCoV-OC43; NC005147), HCoV-HKU1 (NC006577), HCoV-229E (NC002645), HCoV-NL63 (NC005831), Middle East respiratory syndrome coronavirus (HCoV-MERS; KF192507), avian infectious bronchitis virus (IBV; NC001451), beluga whale CoV SW1 (BWCoV; NC010646). Scale bar indicates genetic distance, estimated with a WAG+G model implemented in MEGA5 (www.megasoftware.net).

  • Table 1   Predicted ORFs in the genomes of bat CoVs

    ORFs

    GD

    HB

    FJ

    HN

    AH

    JX

    Position

    Length (nt)

    Position

    Length (nt)

    Position

    Length (nt)

    Position

    Length (nt)

    Position

    Length (nt)

    Position

    Length (nt)

    ORF1a

    271–12,966

    12,693

    270–12,944

    12,672

    269–12,943

    12,672

    269–12,943

    12,672

    273–13,076

    12,801

    274–13,077

    12,801

    ORF1b

    12,936–20,960

    8,022

    12,914–20,938

    8,022

    12,913–20,937

    8,022

    12,913–20,937

    8,022

    13,046–21,067

    8,019

    13,047–21,068

    8,019

    NSP1

    271–600

    330

    270–599

    330

    269–598

    330

    269–598

    330

    273–599

    327

    274–600

    327

    NSP2

    601–2,943

    2,343

    600–2,942

    2,343

    599–2,941

    2,343

    599–2,941

    2,343

    600–2,951

    2,352

    601–2,952

    2,352

    NSP3

    2,944–8,175

    5,232

    2,943–8,153

    5,211

    2,942–8,152

    5,211

    2,942–8,152

    5,211

    2,952–8,288

    5,337

    2,953–8,289

    5,337

    NSP4

    8,176–9,600

    1,425

    8,154–9,578

    1,425

    8,153–9,577

    1,425

    8,153–9,577

    1,425

    8,289–9,710

    1,422

    8,290–9,711

    1,422

    NSP5

    9,601–10,506

    906

    9,579–10,484

    906

    9,578–10,483

    906

    9,578–10,483

    906

    9,711–10,616

    906

    9,712–10,617

    906

    NSP6

    10,507–11,343

    837

    10,485–11,321

    837

    10,484–11,320

    837

    10,484–11,320

    837

    10,617–11,453

    837

    10,618–11,454

    837

    NSP7

    11,344–11,592

    249

    11,322–11,570

    249

    11,321–11,569

    249

    11,321–11,569

    249

    11,454–11,702

    249

    11,455–11,703

    249

    NSP8

    11,593–12,174

    582

    11,571–12,152

    582

    11,570–12,151

    582

    11,570–12,151

    582

    11,703–12,284

    582

    11,704–12,285

    582

    NSP9

    12,175–12,504

    330

    12,153–12,482

    330

    12,152–12,481

    330

    12,152–12,481

    330

    12,285–12,614

    330

    12,286–12,615

    330

    NSP10

    12,505–12,912

    408

    12,483–12,890

    408

    12,482–12,889

    408

    12,482–12,889

    408

    12,615–13,022

    408

    12,616–13,023

    408

    NSP11

    12,913–12,966

    54

    12,891–12,944

    54

    12,890–12,943

    54

    12,890–12,943

    54

    13,023–13,076

    54

    13,024–13,077

    54

    NSP12

    12,913–15,692

    2,781

    12,891–15,670

    2,781

    12,890–15,669

    2,781

    12,890–15,669

    2,781

    13,023–15,802

    2,781

    13,024–15,803

    2,781

    NSP13

    15,693–17,483

    1,791

    15,671–17,461

    1,791

    15,670–17,460

    1,791

    15,670–17,460

    1,791

    15,803–17,584

    1,782

    15,804–17,585

    1,782

    NSP14

    17,484–19,040

    1,557

    17,462–19,018

    1,557

    17,461–19,017

    1,557

    17,461–19,017

    1,557

    17,585–19,147

    1,563

    17,586–19,145

    1,560

    NSP15

    19,041–20,057

    1,017

    19,019–20,035

    1,017

    19,018–20,034

    1,017

    19,018–20,034

    1,017

    19,148–20,164

    1,017

    19,146–20,165

    1,020

    NSP16

    20,058–20,960

    900

    20,036–20,938

    900

    20,035–20,937

    900

    20,035–20,934

    900

    20,165–21,067

    900

    20,166–21,068

    900

    S

    20,962–25,098

    4,134

    20,935–25,059

    4,122

    20,939–25,075

    4,134

    20,939–25,075

    4,134

    21,069–25,196

    4,125

    21,070–25,200

    4,128

    ORF3

    25,098–25,766

    666

    25,059–25,727

    666

    25,075–25,743

    666

    25,075–25,743

    666

    25,196–25,855

    657

    25,200–25,859

    657

    E

    25,750–25,974

    222

    25,711–25,935

    222

    25,727–25,951

    222

    25,727–25,951

    222

    25,849–26,073

    222

    25,853–26,077

    222

    M

    25,984–26,742

    756

    25,945–26,709

    762

    25,961–26,719

    756

    25,961–26,719

    756

    26,080–26,841

    759

    26,084–26,842

    756

    N

    26,791–28,059

    1,266

    26,758–28,026

    1,266

    26,768–28,036

    1,266

    26,768–28,036

    1,266

    26,862–28,031

    1,167

    26,863–28,032

    1,167

    ORF7a

    27,809–27,979

    168

    27,776–28,522

    744

    27,786–28,532

    744

    27,786–28,505

    717

    ORF7b

    28,034–28,528

    492

    BtMf-AlphaCoV/Guangdong2012 (GD), BtMf-AlphaCoV/Hubei2013 (HB), BtMf-AlphaCoV/ Fujian2012 (FJ), BtMf-AlphaCoV/Henan2013 (HN), BtMf-AlphaCoV/Anhui2011 (AH), and BtMf- AlphaCoV/Jiangxi2012 (JX).

  • Table 2   Percent nucleotide identity between whole genomes and percent amino acid similarities between viral protein sequences in bat CoVs

    Nucleotide or protein

    Virus

    Lineage 1

    Lineage 2

    GD

    HB

    FJ

    HN

    AH

    JX

    1A

    Genome

    HKU8

    91.8

    86.1

    82.2

    81.6

    67.7

    67.6

    67.7

    GD

    -

    82.1

    85.4

    85.7

    68.6

    68.5

    68.5

    HB

    -

    -

    92.8

    91.9

    68.1

    68.0

    68.0

    FJ

    -

    -

    -

    97.0

    68.8

    68.8

    68.8

    HN

    -

    -

    -

    -

    68.7

    68.7

    68.6

    AH

    -

    -

    -

    -

    -

    96.2

    96.2

    JX

    -

    -

    -

    -

    -

    -

    96.0

    ORF1a

    HKU8

    99.0

    87.2

    87.1

    87.3

    63.4

    63.4

    63.0

    GD

    -

    87.6

    87.5

    87.6

    63.5

    63.5

    63.2

    HB

    -

    -

    99.2

    99.5

    63.6

    63.7

    63.3

    FJ

    -

    -

    -

    99.3

    63.7

    63.7

    63.3

    HN

    -

    -

    -

    -

    63.6

    63.6

    63.2

    AH

    -

    -

    -

    -

    -

    98.5

    97.7

    JX

    -

    -

    -

    -

    -

    -

    98.4

    ORF1b

    HKU8

    99.6

    98.2

    98.2

    98.2

    87.9

    87.7

    87.4

    GD

    -

    98.3

    98.2

    98.3

    88.0

    87.8

    87.5

    HB

    -

    -

    99.8

    99.8

    88.0

    87.8

    87.5

    FJ

    -

    -

    -

    99.9

    87.9

    87.7

    87.4

    HN

    -

    -

    -

    -

    87.9

    87.7

    87.4

    AH

    -

    -

    -

    -

    -

    99.8

    99.4

    JX

    -

    -

    -

    -

    -

    -

    99.3

    RDRP

    HKU8

    99.8

    97.1

    97.1

    97.0

    90.1

    89.9

    90.0

    GD

    -

    97.1

    97.1

    97.0

    90.1

    89.9

    90.0

    HB

    -

    -

    100.0

    99.9

    90.2

    90.0

    90.1

    FJ

    -

    -

    -

    99.9

    90.2

    90.0

    90.1

    HN

    -

    -

    -

    -

    90.1

    89.9

    90.0

    AH

    -

    -

    -

    -

    -

    99.8

    99.9

    JX

    -

    -

    -

    -

    -

    -

    99.7

    S

    HKU8

    52.9

    95.7

    53.5

    53.5

    49.0

    48.4

    49.1

    GD

    -

    52.5

    87.8

    87.5

    61.0

    60.7

    60.6

    HB

    -

    -

    52.7

    52.8

    49.1

    48.6

    49.2

    FJ

    -

    -

    -

    98.0

    60.7

    59.6

    60.5

    HN

    -

    -

    -

    -

    60.9

    59.6

    60.6

    AH

    -

    -

    -

    -

    -

    93.2

    93.2

    JX

    -

    -

    -

    -

    -

    -

    91.6

    ORF3

    HKU8

    97.8

    98.2

    97.8

    97.3

    46.3

    46.3

    46.3

    GD

    -

    99.6

    99.1

    98.7

    46.3

    46.3

    46.3

    HB

    -

    -

    99.6

    99.1

    46.3

    46.3

    46.3

    FJ

    -

    -

    -

    99.6

    46.3

    46.3

    46.3

    HN

    -

    -

    -

    -

    46.3

    46.3

    46.3

    AH

    -

    -

    -

    -

    -

    99.5

    99.1

    JX

    -

    -

    -

    -

    -

    -

    98.6

    E

    HKU8

    98.7

    98.7

    98.7

    98.7

    70.7

    70.7

    70.7

    GD

    -

    100.0

    100.0

    100.0

    70.7

    70.7

    70.7

    HB

    -

    -

    100.0

    100.0

    70.7

    70.7

    70.7

    FJ

    -

    -

    -

    100.0

    70.7

    70.7

    70.7

    HN

    -

    -

    -

    -

    70.7

    70.7

    70.7

    AH

    -

    -

    -

    -

    -

    100.0

    100.0

    JX

    -

    -

    -

    -

    -

    -

    100.0

    M

    HKU8

    85.6

    85.3

    85.6

    85.6

    72.2

    72.5

    73.0

    GD

    -

    93.7

    99.6

    99.2

    73.3

    73.6

    73.1

    HB

    -

    -

    93.7

    93.7

    71.5

    71.8

    72.9

    FJ

    -

    -

    -

    99.6

    73.3

    73.6

    73.1

    HN

    -

    -

    -

    -

    72.9

    73.2

    73.1

    AH

    -

    -

    -

    -

    -

    99.6

    93.3

    JX

    -

    -

    -

    -

    -

    -

    93.7

    (To be continued on the next page)

    (Continued)

    Nucleotide or protein

    Virus

    Lineage 1

    Lineage 2

    GD

    HB

    FJ

    HN

    AH

    JX

    1A

    N

    HKU8

    93.9

    88.9

    88.2

    87.9

    64.3

    64.1

    64.3

    GD

    -

    91.5

    90.3

    90.1

    63.8

    63.6

    63.8

    HB

    -

    -

    98.6

    97.9

    65.9

    65.6

    65.6

    FJ

    -

    -

    -

    98.3

    66.1

    65.9

    65.9

    HN

    -

    -

    -

    -

    65.6

    65.4

    65.4

    AH

    -

    -

    -

    -

    -

    99.7

    98.7

    JX

    -

    -

    -

    -

    -

    -

    99.0

    ORF7

    HKU8

    61.0

    84.7

    84.8

    59.0

    GD

    -

    61.3

    61.0

    96.5

    HB

    -

    -

    97.9

    61.7

    FJ

    -

    -

    -

    63.0

    HN

    -

    -

    -

    -

    BtMf-AlphaCoV/Guangdong2012 (GD), BtMf-AlphaCoV/Hubei2013 (HB), BtMf-AlphaCoV/ Fujian2012 (FJ), BtMf-AlphaCoV/Henan2013 (HN), BtMf-AlphaCoV/Anhui2011 (AH), and BtMf- AlphaCoV/Jiangxi2012 (JX), HKU8, and 1A.

  • Table 3   Transcription regulatory sequences (TRSs) for six bat CoVs

    ORF TRS

    CoV

    TRS sequence

    Nucleotide

    position

    Leader

    TRS

    GD

    CUCAACUAAACGAAAU

    69

    HB

    CUCAACUAAACGAAAU

    68

    FJ

    CUCAACUAAACGAAAU

    67

    HN

    CUCAACUAAACGAAAU

    67

    AH

    CUCAACUAAACGAAAU

    68

    JX

    CUCAACUAAACGAAAU

    69

    S

    GD

    UUCAACUAAAUAAAAUG

    20,953

    HB

    UUCAACUAAAUG

    20,931

    FJ

    UUCAACUAAAUAAAAUG

    20,930

    HN

    UUCAACUAAAUAAAAUG

    20,930

    AH

    UUCAACUAAAUAAAAUG

    21,060

    JX

    UUCAACUAAAUAAAAUG

    21,061

    ORF3

    GD

    UACAACAAUACGAAGUN21AUG

    25,066

    HB

    UACAACAAUACGAAGUN21AUG

    25,027

    FJ

    UACAACAAUACGAAGUN21AUG

    25,043

    HN

    UACAACAAUACGAAGUN21AUG

    25,043

    AH

    UACAACGUUACGAAAUN21AUG

    25,164

    JX

    UACAACGUUACGAAAUN21AUG

    25,168

    E

    GD

    UACAACUCUACGAAGAUG

    25,740

    HB

    UACAACUCUACGAAGAUG

    25,701

    FJ

    UACAACUCUACGAAGAUG

    25,717

    HN

    UACAACUCUACGAAGAUG

    25,717

    AH

    UUCAACUACACGAAGAUG

    25,839

    JX

    UUCAACUACACGAAGAUG

    25,843

    M

    GD

    GAUGUCUAAACGAACAAAAUG

    25,971

    HB

    GAUGUCUAAACGAACAAAAUG

    25,932

    FJ

    GAUGUCUAAACGAACAAAAUG

    25,948

    HN

    GAUGUCUAAACGAACAAAAUG

    25,948

    AH

    AAUGUCUAAACGAGAAUG

    26,070

    JX

    AAUGUCUAAACGAGAAUG

    26,074

    N

    GD

    AUAAACUAAACAAGUGN36AUG

    26,744

    HB

    AUAAACUAAACAAGUGN36AUG

    26,711

    FJ

    AUAAACUAAACAAGUGN36AUG

    26,721

    HN

    AUAAACUAAACAAGUGN36AUG

    26,721

    AH

    UUAAACUAAACAAGAAN8AUG

    26,843

    JX

    UUAAACUAAACAAGAAN8AUG

    26,844

    ORF7

    GD

    GAUUGCUGAAUUGCUAN88AUG

    27,710

    HB

    AAUUGCUGAACUGAUUN88AUG

    27,677

    FJ

    AAUUGCUGAAUUGAUUN88AUG

    27,687

    HN

    AAUUGCUGAACUGAUCN88AUG

    27,687

    For putative ORFs, we aligned the TRS that preceded the start codon AUG with the leader TRS. The core sequence is indicated in a box. The start codons of genes are in bold type.

qqqq

Contact and support