the National Natural Science Foundation of China(21621004,21575101,21622404)
This work was supported by the National Natural Science Foundation of China (21621004, 21575101, 21622404).
The authors declare that they have no conflict of interest.
These authors contributed equally to this work.
The supporting information is available online at
[1] Yang D, Hartman MR, Derrien TL, Hamada S, An D, Yancey KG, Cheng R, Ma M, Luo D. Acc Chem Res, 2014, 47: 1902-1911 CrossRef PubMed Google Scholar
[2] Wang F, Liu X, Willner I. Angew Chem Int Ed, 2015, 54: 1098-1129 CrossRef PubMed Google Scholar
[3]
Song P, Ye D, Song S, Wang L, Zuo X.
[4]
Chen J, Yuan S, Song Y, Ma Q, Qi X, Wu Z.
[5]
Shao Y, Li C, Zhou X, Wu F, Jia H, Wang Y, Liu D.
[6] Pei H, Zuo X, Zhu D, Huang Q, Fan C. Acc Chem Res, 2014, 47: 550-559 CrossRef PubMed Google Scholar
[7] Seeman NC. Nature, 2003, 421: 427-431 CrossRef PubMed ADS Google Scholar
[8] Storhoff JJ, Mirkin CA. Chem Rev, 1999, 99: 1849-1862 CrossRef Google Scholar
[9] Geng J, Yao C, Kou X, Tang J, Luo D, Yang D. Adv Healthcare Mater, 2018, 7: 1700998 CrossRef PubMed Google Scholar
[10] Kahn JS, Hu Y, Willner I. Acc Chem Res, 2017, 50: 680-690 CrossRef PubMed Google Scholar
[11] Bian B, Zhang YY, Dong YC, Wu F, Wang C, Wang S, Xu Y, Liu DS. Sci China Chem, 2018, 61: 1568-1571 CrossRef Google Scholar
[12] Liu Y, Hu X, Fu T, Wang R, Tan W. Sci China Chem, 2019, 62: 407-408 CrossRef Google Scholar
[13] Shao Y, Jia H, Cao T, Liu D. Acc Chem Res, 2017, 50: 659-668 CrossRef PubMed Google Scholar
[14] Zinchenko A, Che Y, Taniguchi S, Lopatina LI, Sergeyev VG, Murata S. J Nanopart Res, 2016, 18: 179 CrossRef ADS Google Scholar
[15] Mao X, Chen G, Wang Z, Zhang Y, Zhu X, Li G. Chem Sci, 2018, 9: 811-818 CrossRef PubMed Google Scholar
[16] Caliari SR, Burdick JA. Nat Methods, 2016, 13: 405-414 CrossRef PubMed Google Scholar
[17] Cangialosi A, Yoon CK, Liu J, Huang Q, Guo J, Nguyen TD, Gracias DH, Schulman R. Science, 2017, 357: 1126-1130 CrossRef PubMed ADS Google Scholar
[18] Wu Y, Wang D, Willner I, Tian Y, Jiang L. Angew Chem Int Ed, 2018, 57: 7790-7794 CrossRef PubMed Google Scholar
[19] Yang L, Yao C, Li F, Dong Y, Zhang Z, Yang D. Small, 2018, 14: 1800185 CrossRef PubMed Google Scholar
[20] Nöll T, Wenderhold-Reeb S, Schönherr H, Nöll G. Angew Chem Int Ed, 2017, 56: 12004-12008 CrossRef PubMed Google Scholar
[21] Cheng E, Xing Y, Chen P, Yang Y, Sun Y, Zhou D, Xu L, Fan Q, Liu D. Angew Chem Int Ed, 2009, 48: 7660-7663 CrossRef PubMed Google Scholar
[22] Li C, Faulkner-Jones A, Dun AR, Jin J, Chen P, Xing Y, Yang Z, Li Z, Shu W, Liu D, Duncan RR. Angew Chem Int Ed, 2015, 54: 3957-3961 CrossRef PubMed Google Scholar
[23] Wang J, Chao J, Liu H, Su S, Wang L, Huang W, Willner I, Fan C. Angew Chem Int Ed, 2017, 56: 2171-2175 CrossRef PubMed Google Scholar
[24] Um SH, Lee JB, Park N, Kwon SY, Umbach CC, Luo D. Nat Mater, 2006, 5: 797-801 CrossRef PubMed ADS Google Scholar
[25] Park N, Um SH, Funabashi H, Xu J, Luo D. Nat Mater, 2009, 8: 432-437 CrossRef PubMed ADS Google Scholar
[26] Lee JB, Peng S, Yang D, Roh YH, Funabashi H, Park N, Rice EJ, Chen L, Long R, Wu M, Luo D. Nat Nanotech, 2012, 7: 816-820 CrossRef PubMed ADS Google Scholar
[27] Xing Y, Cheng E, Yang Y, Chen P, Zhang T, Sun Y, Yang Z, Liu D. Adv Mater, 2011, 23: 1117-1121 CrossRef PubMed Google Scholar
[28] Xu W, Huang Y, Zhao H, Li P, Liu G, Li J, Zhu C, Tian L. Chem Eur J, 2017, 23: 18276-18281 CrossRef PubMed Google Scholar
[29] Huang Y, Xu W, Liu G, Tian L. Chem Commun, 2017, 53: 3038-3041 CrossRef PubMed Google Scholar
[30] Li J, Zheng C, Cansiz S, Wu C, Xu J, Cui C, Liu Y, Hou W, Wang Y, Zhang L, Teng I, Yang HH, Tan W. J Am Chem Soc, 2015, 137: 1412-1415 CrossRef PubMed Google Scholar
[31]
Bartlett JMS, Stirling D.
[32] Eguchi Y, Kato T, Tanaka T, Maruyama T. Chem Commun, 2017, 53: 5802-5805 CrossRef PubMed Google Scholar
[33] Hartman MR, Yang D, Tran TNN, Lee K, Kahn JS, Kiatwuthinon P, Yancey KG, Trotsenko O, Minko S, Luo D. Angew Chem Int Ed, 2013, 52: 8699-8702 CrossRef PubMed Google Scholar
[34] Yang D, Peng S, Hartman MR, Gupton-Campolongo T, Rice EJ, Chang AK, Gu Z, Lu GQM, Luo D. Sci Rep, 2013, 3: 3165 CrossRef PubMed ADS Google Scholar
[35] Perez JG, Stark JC, Jewett MC. Cold Spring Harb Perspect Biol, 2016, 8: a023853 CrossRef PubMed Google Scholar
Figure 1
Agarose gel electrophoresis analysis of PCR produced Acry-eGFP and the effect of concentration of APS on the free radical polymerization of Acry-eGFP. (a) Schematic diagram of the preparation of polymerized-gene. (b) Gel electrophoresis image of Acry-eGFP with
Scheme 1
Scheme of the preparation of gene hydrogel and protein expression in a CFPS system. Acry-primer sequences hybrided with plasmid DNA template and were extended by polymerase to synthesize Acry-gene via PCR process. Acry-gene was afterwards cross-linked via free radical polymerization of methacrylamide groups to form a 3D gene network, namely gene hydrogel. The gene hydrogel preserved the biological function of DNA and expressed protein in CFPS system (color online).
Figure 2
Formation and rheological property
Figure 3
SEM and fluorescence microscopy of gene hydrogel. (a, b) The morphology of Hydrogel-1235 (the arrow indicates nanofibers); (c) the fluorescence microscope image of the Hydrogel-1235 (stained with SYBR Green I); (d, e) the morphology of Hydrogel-2393; (f) the fluorescence microscope image of the Hydrogel-2393 (stained with SYBR Green I) (color online).
Figure 4
Protein expression of gene hydrogel in a CFPS system. (a) Schematic illustration of protein expression in a gene hydrogel containing CFPS system; (b) time course of the eGFP expressed from Acry-eGFP Hydrogel-1235 in a CFPS system; (c) time course of the eGFP expressed from Acry-eGFP Hydrogel-2393 in a CFPS system (color online).
Name | Sequence | Use |
Primer 1 | TAACCGTATTACCGCCTTTGAGT | Forward primer for PCR |
Primer 2 | GCGGGCCTCTTCGCTATTA | Reverse primer for PCR |
Primer 3 | GCGGGCCTCTTCGCTATTA | Reverse primer for PCR |