logo

SCIENCE CHINA Life Sciences, Volume 60 , Issue 12 : 1357-1363(2017) https://doi.org/10.1007/s11427-017-9263-6

The persistent prevalence and evolution of cross-family recombinant coronavirus GCCDC1 among a bat population:a two-year follow-up

More info
  • ReceivedSep 11, 2017
  • AcceptedOct 23, 2017
  • PublishedDec 1, 2017

Abstract


Funded by

grants from the National Key Research and Development Program of China(2017YFC1200202)

the National Natural Science Foundation of China(81290342,81461168030)

the Major Special Projects for Infectious Disease Research of China(2016ZX10004222-003)

and China National Grand S&T Special Project(2014ZX10004-001-006)

The World Academy of Sciences(TWAS)

data collection and analysis

decision to publish

or preparation of the manuscript.


Acknowledgment

We appreciate the great efforts of Drs. Yongming Zhou, Honghua Wen, Huaxing Liu, who participated in the collection of the bat samples. This work was supported by the National Key Research and Development Program of China (2017YFC1200202), the National Natural Science Foundation of China (81290342, 81461168030), the Major Special Projects for Infectious Disease Research of China (2016ZX10004222-003), and China National Grand S&T Special Project (2014ZX10004-001-006). Joseph O. Obameso was supported by CAS-TWAS President’s Fellowship of the University of Chinese Academy of Sciences (UCAS) and The World Academy of Sciences (TWAS). George F. Gao is a leading principle investigator of the NSFC Innovative Research Group (81621091). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.


Interest statement

The author(s) declare that they have no conflict of interest.


References

[1] Baric, R.S., Fu, K., Chen, W., and Yount, B. (1995). High recombination and mutation rates in mouse hepatitis virus suggest that coronaviruses may be potentially important emerging viruses. Adv Exp Med Biol 380, 571–576. Google Scholar

[2] Calisher C.H., Childs J.E., Field H.E., Holmes K.V., Schountz T.. Bats: important reservoir hosts of emerging viruses. Clin Microbiol Rev, 2006, 19: 531-545 CrossRef PubMed Google Scholar

[3] Carrasco, L., Otero, M.J., and Castrillo, J.L. (1989). Modification of membrane permeability by animal viruses. Pharmacol Ther 40, 171–212. Google Scholar

[4] Carrasco, L., Perez, L., Irurzun, A., Lama, J., Martinez-Abarca, F., Rodriguez, P., Guinea, R., Castrillo, J.L., Sanz, M.A., and Ayala, M.J. (1993). Regulation of Gene Expression in Animal Viruses. (New York: Plenum Publishing Corp.), pp. 283–305. Google Scholar

[5] Du J., Yang L., Ren X., Zhang J., Dong J., Sun L., Zhu Y., Yang F., Zhang S., Wu Z., Jin Q.. Genetic diversity of coronaviruses in Miniopterus fuliginosus bats. Sci China Life Sci, 2016, 59: 604-614 CrossRef PubMed Google Scholar

[6] Ge X.Y., Li J.L., Yang X.L., Chmura A.A., Zhu G., Epstein J.H., Mazet J.K., Hu B., Zhang W., Peng C., Zhang Y.J., Luo C.M., Tan B., Wang N., Zhu Y., Crameri G., Zhang S.Y., Wang L.F., Daszak P., Shi Z.L.. Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature, 2013, 503: 535-538 CrossRef PubMed ADS Google Scholar

[7] Hu B., Zeng L.P., Yang X.L., Ge X.Y., Zhang W., Li B., Xie J.Z., Shen X.R., Zhang Y.Z., Wang N., Luo D.S., Zheng X.S., Wang M.N., Daszak P., Wang L.F., Cui J., Shi Z.L.. Discovery of a rich gene pool of bat SARS-related coronaviruses provides new insights into the origin of SARS coronavirus. PLoS Pathog, 2017, 13: e1006698 CrossRef PubMed Google Scholar

[8] Huang C., Liu W.J., Xu W., Jin T., Zhao Y., Song J., Shi Y., Ji W., Jia H., Zhou Y., Wen H., Zhao H., Liu H., Li H., Wang Q., Wu Y., Wang L., Liu D., Liu G., Yu H., Holmes E.C., Lu L., Gao G.F.. A bat-derived putative cross-family recombinant coronavirus with a reovirus gene. PLoS Pathog, 2016, 12: e1005883 CrossRef PubMed Google Scholar

[9] Jackwood M.W., Hall D., Handel A.. Molecular evolution and emergence of avian gammacoronaviruses. Infect Genet Evol, 2012, 12: 1305-1311 CrossRef PubMed Google Scholar

[10] Lai, M.M.C. (1996). Recombination in large RNA viruses: coronaviruses. Semin Virol 7, 381–388. Google Scholar

[11] Lau S.K.P., Woo P.C.Y., Li K.S.M., Huang Y., Tsoi H.W., Wong B.H.L., Wong S.S.Y., Leung S.Y., Chan K.H., Yuen K.Y.. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc Natl Acad Sci USA, 2005, 102: 14040-14045 CrossRef ADS Google Scholar

[12] Lelli D., Papetti A., Sabelli C., Rosti E., Moreno A., Boniotti M.B.. Detection of coronaviruses in bats of various species in italy. Viruses, 2013, 5: 2679-2689 CrossRef PubMed Google Scholar

[13] Li W., Shi Z., Yu M., Ren W., Smith C., Epstein J.H., Wang H., Crameri G., Hu Z., Zhang H., Zhang J., McEachern J., Field H., Daszak P., Eaton B.T., Zhang S., Wang L.F.. Bats are natural reservoirs of SARS-like coronaviruses. Science, 2005, 310: 676-679 CrossRef PubMed ADS Google Scholar

[14] Li Z., Liu D., Ran X., Liu C., Guo D., Hu X., Tian J., Zhang X., Shao Y., Liu S., Qu L.. Characterization and pathogenicity of a novel mammalian orthoreovirus from wild short-nosed fruit bats. Infect Genet Evol, 2016, 43: 347-353 CrossRef PubMed Google Scholar

[15] López-Roig M., Bourhy H., Lavenir R., Serra-Cobo J.. Seroprevalence dynamics of european bat lyssavirus type 1 in a multispecies bat colony. Viruses, 2014, 6: 3386-3399 CrossRef PubMed Google Scholar

[16] Minskaia E., Hertzig T., Gorbalenya A.E., Campanacci V., Cambillau C., Canard B., Ziebuhr J.. Discovery of an RNA virus 3′→5′ exoribonuclease that is critically involved in coronavirus RNA synthesis. Proc Natl Acad Sci USA, 2006, 103: 5108-5113 CrossRef PubMed ADS Google Scholar

[17] Sokolova, T.M., Uryvaev, L.V., Selivanova, T.K., Bobrova, O.V., Lebedev, A., and Bystrov, N.S. (1996). Recombination of alpha-viruses during mixed infection in cultured cells. Formation of hybrid forms of RNA of Venezuelan equine encephalomyelitis virus and Karelian fever virus in the region of genes for nucleocapsid and envelope proteins. Vopr Virusol 41, 245–252. Google Scholar

[18] Wang, Q., Qi, J., Yuan, Y., Xuan, Y., Han, P., Wan, Y., Ji, W., Li, Y., Wu, Y., Wang, J., Iwamoto, A., Woo, P.C., Yuen, K.Y., Yan, J., Lu, G., and Gao, G.F. (2014). Bat origins of MERS-CoV supported by bat coronavirus HKU4 usage of human receptor CD26. Cell Host Microbe 16, 328–337. Google Scholar

[19] Woo P.C.Y., Lau S.K.P., Lam C.S.F., Lau C.C.Y., Tsang A.K.L., Lau J.H.N., Bai R., Teng J.L.L., Tsang C.C.C., Wang M., Zheng B.J., Chan K.H., Yuen K.Y.. Discovery of seven novel mammalian and avian coronaviruses in the genus deltacoronavirus supports bat coronaviruses as the gene source of alphacoronavirus and betacoronavirus and avian coronaviruses as the gene source of gammacoronavirus and deltacoronavirus. J Virol, 2012, 86: 3995-4008 CrossRef PubMed Google Scholar

[20] Zumla A., Chan J.F.W., Azhar E.I., Hui D.S.C., Yuen K.Y.. Coronaviruses—drug discovery and therapeutic options. Nat Rev Drug Discov, 2016, 15: 327-347 CrossRef PubMed Google Scholar

  • Figure 1

    Phylogenetic analyses of Ro-BatCoV GCCDC1 for three sampling periods. Evolutionary trees of RdRp (A) and P10 (B) constructed for the samples collected from May, 2014 to Oct., 2015 has indicated by different colors as labeled. The maximum-likelihood trees were constructed with 1,000 replication available in MGEA6.

  • Figure 2

    Phylogenetic relationships of Ro-BatCoV GCCDC1 compared to other viruses. Phylogenetic trees of the p10 sequence of Ro-BatCoV GCCDC1 together with the p10 genes from other reoviruses. The phylograms were constructed by using MEGA6 software package to determine the maximum-likelihood tree for the sequence.

  • Figure 3

    Multiple sequence alignment of Ro-BatCoV GCCDC1 genes based on samples from three sampling periods. Sequence alignment of deduced amino acid of RdRp (A) and p10 proteins (B). Consensus and sequence logo for conserved amino acid residues are shown on top of the alignment. The residues with color indicate the position of mutation.

  • Figure 4

    Recombination analysis of Ro-BatCoV GCCDC1. A, The recombination model for Ro-BatCoV GCCDC1 based on the different groups of RdRp (Group I and Group II) and p10 proteins (Group A and Group B). The groups are based on the different combinations of polymorphic amino acid residues in Ro-BatCoV GCCDC1. B, The ratios of different recombinants of Ro-BatCoV GCCDC1 revealed two new groups, IIA and IIB

  • Table 1   Summary of sampling detail and coronavirus infections in bats

    Sampling time

    Bats with swabsamples collected

    Bats with CoVpositive (%)*

    May 2014

    118

    47 (39.8%)

    October 2014

    270

    70 (38.8%)

    October 2015

    180

    64 (35.6%)

    *, All the positive samples were defined based on the PCR amplicons with the length of 228 bp of Ro-BatCoV GCCDC1 RdRp as described in Table2. 97 RdRp sequences out of the 181 samples which had the corresponding p10 sequences were utilized for the GCCDC evolution.

  • Table 2   The primers for coronaviridae gene identification and amplification

    Primer name

    Target gene

    Sequence (5′→3′)

    G+C (%)

    Tm (oC)

    Length of the amplification

    fragments

    RdRp-OF

    RdRp

    TGTTATTGGAACCACGAAGTTYTAYGGNGGNTG

    42.1

    51.3

    OF+OR=299 bp

    RdRp-IF

    RdRp

    GTTTTGTTCTTATGGGTTGGGATTAYCCNAARTGYGA

    42.1

    52.3

    IF+OR=228 bp

    RdRp-OR

    RdRp

    TAGTAGCATCTCCGCTGCTAGTNCCNCCNGGYTT

    52.6

    53.4

    CoV-p10-OF

    p10

    GAAAGGGAGACTAAGAAGA

    42.1

    50.8

    OF+OR=715 bp

    CoV-p10-OR

    p10

    ACAGGCTATAACTGTAAATG

    35.0

    49.2

    CoV-p10-IF

    p10

    GCAGATGAGAATGACAAACCCAA

    43.5

    56.0

    IF+IR=447 bp

    CoV-p10-IR

    p10

    GCAGCAAGCAAGCAGAGCAA

    55.0

    57.4

qqqq

Contact and support